Journal: Immunity

Article Title: The white adipose tissue is a reservoir for memory T cells that promotes protective memory responses to infection

doi: 10.1016/j.immuni.2017.11.009

Figure Lengend Snippet: (A–E) ATs from naïve C57BL/6 mice were analyzed by flow cytometry. (A) Representative plots of transcription factor expression or cytokine production by CD8+ or CD4+ T cells from the mAT after PMA/ionomycin restimulation with BFA. (B) Numbers of CD8+ T cells and non-Treg CD4+ T cells from the mAT producing the indicated cytokine. (C) Frequencies of IFN-γ- and TNF-α-producing CD8+ and CD4+ T cells after PMA/ionomycin restimulation with BFA isolated from gAT, scAT, and mAT. (D) CD8+ (top) and CD4+ (bottom) T cells isolated from the mAT. Left: representative plots of CD44 and CD62L expression, Right: representative histograms of CD69 expression on CD44+CD62L− (red) or CD44−CD62L+ (blue) T cells. (E) Numbers of central memory (Tcm: CD44+CD62L+), effector memory (Tem: CD44+CD62L−CD69−) and resident memory (Trm: CD44+CD62L−CD69+) CD8+ and CD4+ T cells per gram of gAT, scAT, and mAT. (F) Conjoined pairs of naïve CD45.1 and CD45.2 congenic C57BL/6 mice were analyzed 6 weeks after parabiosis surgery to quantify the origin of CD8+ (left) and CD4+ (right) memory T cell subsets (described in (E)) in the spleen (Spl), mLN, siLP, and mAT. The percentage of cells originating from host (black bars) or donor (white bars) animals is shown. nd not detected. (G–K) mAT isolated from healthy rhesus macaques was analyzed by flow cytometry. (G) Representative plot (gated on CD3+CD8+ T cells) indicating the gating strategy for naïve (CD95−CD28lo), central memory or stem cell memory (Tcm/scm) (CD95+CD28+), and Tem/rm (CD95+CD28−) T cells. (H) Representative plots showing CD8+ (left) and CD4+ (right) naïve, Tcm/scm, and Tem/rm T cells. (I) Representative histograms of CD69 expression on CD8+ (left) and CD4+ (right) naïve (shaded) and Tem/rm T cells (blue). (J) Frequencies of CD8+ (left) and CD4+ (right) memory T cell subsets from (HI). (K) Representative plots (gated on CD3+ T cells) from concatenation of all samples, showing cytokine production by T cell subsets. Numbers in representative plots indicate mean±SD. In all bar graphs, error bars represent standard deviation. Data are representative of at least 2 experiments with at least 4 mice, 3 pairs of parabiotic animals, or a total of 3 rhesus macaques. See Figure S1.

Article Snippet: Anti-mouse CD8α (2.43) (depletion) , BioXcell , BE0061.

Techniques: Flow Cytometry, Expressing, Isolation, Standard Deviation

Journal: Immunity

Article Title: The white adipose tissue is a reservoir for memory T cells that promotes protective memory responses to infection

doi: 10.1016/j.immuni.2017.11.009

Figure Lengend Snippet: (A–D) C57BL/6 mice were orally infected with T. gondii. 6 weeks post-infection, T cell populations were evaluated by flow cytometry. (A) Number of IFN-γ+ CD8+ (left) and IFN-γ+ CD4+ (right) T cells from the mAT post PMA/ionomycin activation with BFA. (Student’s t test) (B) Representative plots show T. gondii-specific CD8+ (left) and CD4+ (right) T cells. (C) Representative plots of IFN-γ production by CD44+tgd057:Kb+ CD8+ T cells (left) and TGME49:I-Ab+ CD4+ T cells (right) after PMA/ionomycin stimulation with BFA in the indicated organ. (D) The mean fluorescence intensity (MFI) of IFN-γ+ tgd057:Kb+ CD8+ T cells (left) and IFN-γ+ TGME49:I-Ab+ CD4+ T cells (right) from (C). (E–G) C57Bl/6 mice were orally infected with Yptb WT. At the indicated time points post-infection, T cells were analyzed by flow cytometry. (E) Representative plots of YopE:Kb+ CD8+ T cells in the indicated organs at 15 days post-infection. (F) Time course of the numbers of CD44+YopE:Kb+CD8+ T cells in the mLN, siLP, and mAT. (G) Frequencies of Tcm, Tem, and Trm cells within YopE:Kb+CD8+ T cells in the mAT 31 days post-infection. (H–J) C57BL/6 mice were orally infected with Yptb WT or Yptb ΔyopM. At the indicated time points post-infection, T cell populations were analyzed by flow cytometry. (H) Representative plots of YopE:Kb+CD8+ T cells from the mLN or mAT 31 days post-infection. (I) Numbers of CD44+YopE:Kb+CD8+ T cells from the mAT 31 days post-infection. (J) Representative plots of YopE:Kb+ CD8+ T cells from the mAT and gAT >4 weeks post-infection with Yptb ΔyopM. (K) Representative plots of tgd057:Kb+ CD8+ T cells (left) and TGME49:I-Ab+ CD4+ T cells (right) from the gAT and mAT of mice >6 weeks post oral T. gondii infection. (L) Pairs consisting of one naïve and one previously infected (>4 weeks post Yptb ΔyopM infection) congenic C57BL/6 mouse were conjoined and analyzed 6 weeks after parabiosis surgery. The number of YopE:Kb+ CD8+ T cells isolated from the indicated organs of the naive (white bars) or previously infected (black bars) mouse in the pair was calculated. (One way Anova adjusted for multiple comparisons). Numbers in representative plots indicate mean±SD. Error bars in all bar graphs represent standard deviation. Data are representative of at least 2 experiments with at least 3 mice per group or 3 pairs of parabiotic animals. ns not significant, *p<0.05, ****p<0.0001. See Figure S2.

Article Snippet: Anti-mouse CD8α (2.43) (depletion) , BioXcell , BE0061.

Techniques: Infection, Flow Cytometry, Activation Assay, Fluorescence, Isolation, Standard Deviation

Journal: Immunity

Article Title: The white adipose tissue is a reservoir for memory T cells that promotes protective memory responses to infection

doi: 10.1016/j.immuni.2017.11.009

Figure Lengend Snippet: (A–B) Mice were orally infected with Yptb ΔyopM. >4 weeks post-infection, Tem and Trm memory CD8+ T cells were sorted for gene expression analysis by RNA-Seq. (A) Numbers of genes with a ≥2 fold increase (red) or decrease (blue) in expression levels between the indicated populations. (B) Pathway analysis was performed and gene pathways were organized into clusters, represented here as clustergrams showing gene pathways differentially regulated between Trm cells in the siLP and mAT. (C–G) Mice infected with Yptb ΔyopM were analyzed at >4 weeks post-infection. (C) Ki67 expression by Tem and Trm YopE:Kb+CD8+ T cells was determined by flow cytometric analysis. Left hand plots show YopE:Kb+ expression on CD8+ T cells. Center plots show CD69 expression on YopE:Kb+CD8+ cells. Right hand plots show Ki67 expression on Tem and Trm cells. Bar graphs show frequencies of Ki67+YopE:Kb+CD8+ Tem (left) and Trm (right) cells. (D) Representative Vybrant DyeCycle Violet staining of YopE:Kb+CD44+CD8+ T cells from the siLP (blue), spleen (green), and mAT (red). Bar graphs show the percentage of YopE:Kb+CD44+CD8+ Tem and Trm cells in the indicated cell cycle stages in the siLP (left), spleen (center), and mAT (right). (E) >4 weeks post-infection with the Yptb ΔyopM, mice received BrdU for 12 days. The percentage of BrdU+YopE:Kb+CD44+ CD8+ T cells found in the intraepithelial lymphocytes (IEL), lungs, salivary gland (SG), siLP, liver, mAT, and gAT is quantified in the bar graph. (F) >4 weeks post-infection, cells from the siLP, spleen, and mAT were incubated with Bodipy FL C16. Representative histogram indicates Bodipy uptake in YopE:Kb+CD8+ Trm cells (red) or YopE:Kb+CD8+ Tem cells (blue) from the siLP (open) and mAT (shaded). Bar graphs show the quantification of the bodipy MFI. (Student’s t test). (G) >4 weeks post-infection, cells from the siLP, spleen, and mAT were incubated with Mitotracker Deep Red. Representative histograms indicate Mitotracker Deep Red staining in YopE:Kb+CD8+ Trm cells (red) or YopE:Kb+CD8+ Tem cells (blue) from the siLP (open histogram) and mAT (shaded histograms). Bar graphs show the quantification of the Mitotracker Deep Red MFI. Numbers in representative plots indicate mean±SD. Error bars in all graphs represent mean±SD. Data are representative of at least 2 experiments with ≥3 mice per group. One way Anova adjusted for multiple comparisons. **p<0.01, ****p<0.0001 See Figure S3.

Article Snippet: Anti-mouse CD8α (2.43) (depletion) , BioXcell , BE0061.

Techniques: Infection, Gene Expression, RNA Sequencing, Expressing, Staining, Incubation

Journal: Immunity

Article Title: The white adipose tissue is a reservoir for memory T cells that promotes protective memory responses to infection

doi: 10.1016/j.immuni.2017.11.009

Figure Lengend Snippet: (A–D) Mice were either naïve, 6 days post-infection with Yptb (Yptb WT 6 days), >4 weeks post-infection with Yptb ΔyopM (Yptb ΔyopM), or >4 weeks post-infection with Yptb ΔyopM followed by challenge with Yptb for 6 days (Yptb ΔyopM + Yptb WT) before imaging or isolation of cells for flow cytometry. (A) Representative images of the entire mAT from actin-DsRed reporter mice are shown. White arrows indicate FALCs. (B) Number of FALCs per mAT represented as fold change over the number of FALCs per naïve mAT. (C) mATs from CD11c–YFP reporter mice were stained for CD8 and LYVE-1 and imaged by confocal microscopy. CD8, CD11c, and LYVE-1 staining (top) or CD8+ T cells alone (bottom) in areas of the mAT with (left) or without (right) FALCs are shown. (D) Numbers of CD44+YopE:Kb+CD8+ T cells from mAT. (E) Pooled mAT, scAT and gAT isolated from either naïve donors or donors >4 weeks post-infection with Yptb ΔyopM were subcutaneously transplanted into Rag1−/− mice. Rag1−/− mice receiving ATs from previously infected mice were either left untreated or injected with anti-CD4 and anti-CD8 depleting antibodies. 2 weeks post surgery, animals were challenged i.v. with 200 CFU of Yptb WT. Data are representative of at least 2 experiments with ≥5 mice per group. Error bars in all bar graphs represent standard deviation. Statistical comparisons in (B) and (D) were performed using one way Anova adjusted for multiple comparisons. Statistical comparisons in (E) were performed using Log-rank (Mantel Cox) test. ns not significant, *p<0.05, **p<0.01, ****p<0.0001. See Figure S4.

Article Snippet: Anti-mouse CD8α (2.43) (depletion) , BioXcell , BE0061.

Techniques: Infection, Imaging, Isolation, Flow Cytometry, Staining, Confocal Microscopy, Injection, Standard Deviation

Journal: Immunity

Article Title: The white adipose tissue is a reservoir for memory T cells that promotes protective memory responses to infection

doi: 10.1016/j.immuni.2017.11.009

Figure Lengend Snippet: (A–B) >4 weeks post-infection with Yptb ΔyopM, mice were injected i.v. with YopE69–77 peptide or vehicle control (ctrl.) and evaluated by flow cytometry 1 hour post-injection. (A) Representative histogram shows expression of CD69 on YopE:Kb+CD8+ T cells after vehicle control (dotted line) or peptide (gray shading) injection (left) and MFI of CD69 in the indicated organs after the indicated treatment is quantified (right). (B) Representative plots show IFN-γ and TNF-α production by YopE:Kb+CD8+ T cells 1 hour after vehicle control (left) or peptide (right) injection in the indicated organs. Frequencies of IFN-γ+ TNF-α+ YopE:Kb+ CD8+ T cells in the indicated organs are shown in the bar graph. (C) Mice were infected orally with a fluorescent reporter strain of T. gondii. 6 weeks post-infection, mice were injected i.v. with MHC-I and MHC-II peptides or vehicle control and analyzed by flow cytometry 1 hour post injection. Representative plots show IFN-γ and TNF-α in CD44+CD8+ T cells in the indicated organ. Bar graphs show the frequencies of IFN-γ+TNF-α+ cells within the CD44+ CD8+ T cells. (D–E) >4 weeks post-infection with Yptb ΔyopM, mice were injected i.v. with YopE69-77 peptide or an equal volume of vehicle control and evaluated by flow cytometry at 1 and 4 hours post-injection. (D) Representative plots show neutrophils in the indicated organs (gated on live CD45+TCRβ−Siglec F−NK1.1−B220− cells) 4 hours after injection. Bar graph shows frequency of neutrophils at 1 and 4 hours post-injection in the siLP and mAT. (E) Representative plots show monocytes (gated on live CD45+TCR-β−Siglec F−NK1.1−B220−CD11b+Ly-6G−CD64+CCR2+ cells) 4 hours after injection in the indicated organs. Bar graph shows the frequency of monocytes at 1 and 4 hours post-injection in the siLP and mAT. Numbers in representative plots indicate mean±SD. Error bars in all bar graphs represent standard deviation and statistics are calculated using one way Anova adjusted for multiple comparisons. Data are representative of at least 2 experiments with 2–6 mice per group. ns not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. See Figure S5.

Article Snippet: Anti-mouse CD8α (2.43) (depletion) , BioXcell , BE0061.

Techniques: Infection, Injection, Control, Flow Cytometry, Expressing, Standard Deviation

Journal: Immunity

Article Title: The white adipose tissue is a reservoir for memory T cells that promotes protective memory responses to infection

doi: 10.1016/j.immuni.2017.11.009

Figure Lengend Snippet: DATA AND SOFTWARE AVAILABILITY

Article Snippet: Anti-mouse CD8α (2.43) (depletion) , BioXcell , BE0061.

Techniques: Software, Virus, Recombinant, Enzyme-linked Immunosorbent Assay, Isolation, SYBR Green Assay, Staining, Microarray

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: S282 mutation with alanine induced cardiomyocyte death. a, b Representative images of NRVMs at 36 h after transfection with virus carrying rat Cx43-wt, S279A or S282A gene (20 m.o.i. for each) recorded by microscope (a) and time-lapse cell death curve detected by YOYO-1 probe (b). NRVM death with time-lapse was collected from 16 fields in each well, and three wells with subconfluent NRVMs obtained from 40 rat ventricles were assigned for each treatment (Videos 1, 2). c–e Measured by confocal microscopy, representative images of NRVMs transfected with different mutants for 24 h, and then stained with antibody against Cx43, or loaded with Fluo4 to detect Ca2+ transients or Lucifer Yellow (LY) to detect intercellular communication, as indicated (c). Nucleus was stained with Hochest33258. Scale bar: 10 μm. Typical traces of Ca2+ transients illustrate that S282A cells had uncoupled transients (d) and decreased LY uptake (e). *P < 0.05, **P < 0.01, unpaired two-tailed Student’s t test, n = 4–6 independent determinations for each group as indicated

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Mutagenesis, Transfection, Microscopy, Confocal Microscopy, Staining, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Cx43 expression and distribution in NRVMs transfected with different mutants. a–d NRVMs were transfected with virus carrying Cx43-wt, S279A or S282A gene (20 m.o.i. for each) for 24 h and lysed by RIPA (a, b) or RIPA + junctional/non-junctional isolation treatment (c, d). The lysates were analyzed by Western blot (a, c), and the fold changes in phosphorylated S282 (pS282), pS262, pS368 and Cx43 abundances in relative to those of vector cells (after normalized with GAPDH or β-actin) were thereby detected (b, d). Junctional and non-junctional fractions were referred to cell-membrane and cytosolic fractions to detect Cx43 abundance distributed in both regions (see Methods), respectively, and no difference in their pattern between the two regions was found among the different treatments. *P < 0.05, **P < 0.01, ***P < 0.001, unpaired two-tailed Student’s t test, n = 4–5 independent experiments for each group as indicated

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Expressing, Transfection, Isolation, Western Blot, Plasmid Preparation, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Expression of S282 mutant with alanine activated Fas-apoptotic pathway. a, b Apoptosis in NRVMs transfected with virus carrying Cx43-wt, S279A or S282A gene for 28 h (20 m.o.i. for each), respectively, was detected by annexin V-FITC/PI assay using flow cytometry (a) and caspase-3 ELISA kit (b), n = 4 independent determinations for each group. c Caspase-8 activity in these transfected NRVMs was determined by Western blot with a specific antibody against caspase-8, n = 3 independent determinations for each group. d, e Transfection-time-dependent activation of Fas in NRVMs with S282A mutant was analyzed by Western blot, and fold changes of Fas in these cells after normalized with GAPDH, respectively, in relative to those of control cells were thereby detected (d). The activation of caspase-3 by S282A was significantly inhibited by soluble Fas (sFas, 3 μg/60-mm dish, added to the dish when virus was added) (e), n = 3 independent determinations for each group. f The levels of FADD, DR5, and TNFR were determined by Western blot in cells transfected with S282A or Cx43-wt for 28 h and the fold increases in their abundances in relative to those of control (after normalized with GAPDH) were thereby detected, n = 3–4 independent determinations for each group as indicated. *P < 0.05, **P < 0.01, NS: not significant, unpaired two-tailed Student’s t test or one-way ANOVA (e)

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Expressing, Mutagenesis, Transfection, Flow Cytometry, Enzyme-linked Immunosorbent Assay, Activity Assay, Western Blot, Activation Assay, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Cx43 S282A+/− mice exhibited arrhythmias and cardiomyocyte apoptosis. a Neonatal lethality (24/81) occurred in heterozygous mice (Het) between day 9 and 21 after birth, while no death was found in wild-type mice (WT). b Typical surface ECG recordings show different changes in Het; generally normal ECG, premature ventricular beat (PVB) and ventricular tachycardia (VT), while no arrhythmia was found in WT. Thereby, three groups: Het(1), Het(2) and Het(3) were divided according to the severity of arrhythmias. c Representative photos of animals and hearts from WT, Het(2) and Het(3) groups, and comparisons of the heart weight (HW) and ratio of heart/body weight (BW) between WT and Het groups, n = 8–12 mice for each group as indicated. d Hearts from different groups stained with H&E showed no obvious morphological change, except for a noticeable increase in the extracellular space in Het(2) and (3) ventricles. Scale bar: 20 μm, n = 5 animals for each group. All the animals were detected between day 10 and 14 after birth. *P < 0.05, NS not significant, unpaired two-tailed Student’s t test

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Staining, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Cx43 S282A+/− mice exhibited myocardium apoptosis and fibrosis. a–c Mouse ventricles from three groups were stained with antibody against Cx43 or with SIRIUS Red, MASSON or TUNEL as indicated. Nucleus was stained with Hochest33342. Scale bar: 75 μm for Cx43 staining and 20 μm for other images (a). The analysis data for SIRIUS Red-positive signal (b) and TUNEL-positive cells (c) were displayed, n = 5–6 animals for each group as indicated. d Caspase-8/3 activities determined by ELISA kits, respectively, illustrated significant activations of caspase-8/3 in both Het(2) and Het(3) mice, n = 8 mice for each group. Note that Het(3) mice showed severer apoptosis and fibrosis than Het(2) mice. **P < 0.01, unpaired two-tailed Student’s t test

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Staining, TUNEL Assay, Enzyme-linked Immunosorbent Assay, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Cx43 S282A+/− mice exhibited an activation of Fas/FADD pathway. a–d Lysates from ventricles of WT and Het(1)–(3) (a) and from brain, liver and bone tissues of WT and Het(3) mice (b) were analyzed by Western blot with specific antibodies as indicated, respectively, and fold changes in pS282 and Cx43 (c) and Fas/FADD (d) in relative to those in WT ventricles (after normalized with GAPDH) were thereby detected, n = 8 mice for each group in all the panels, except for five mice for each group in b. e Comparing the values of pS282, Cx43, FADD, TUNEL positive cells (from Fig. 5c) and p-p38/p38 MAPK (from Fig. 7b, d) among the ventricles from different groups showed consistence in the activation of apoptosis pathway (p38/FADD), which was correlated with the level of pS282 but not Cx43 expression. **P < 0.01, ***P < 0.001, NS not significant, unpaired two-tailed Student’s t test

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Activation Assay, Western Blot, TUNEL Assay, Expressing, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Activation of p38 MAPK responsible for the cell death in S282 mutated NRVMs and Cx43-S282A+/− mice. a–d Lysates from S282A-transfected NRVMs (a) and ventricles of WT and Het mice (b) were analyzed by Western blot using specific antibody for phosphorylated p38 MAPK (p-p38) or p38 MAPK, and fold increases in p-p38 in cells (c) and ventricles (d) after normalized with p38 MAPK in relative to their counterpart controls were thereby detected, n = 3–4 independent determinations (c) and 8 mice (d) for each group as indicated. e The activation of p38 MAPK was transfection-time-dependent (data from a) and compared with that in Fas activation (data from Fig. 3d) in S282A transfected cells. f–h The inhibitory effect of SB203580 (SB, 10 μM, added at the time of transfection and harvested 28 h after) on Fas/FADD activation (f, g) and the lowered cell viability (h) induced by S282A transfection were detected by Western blot and 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method, respectively, n = 4 (g) and 8–11 (h) independent determinations for each group as indicated. *P < 0.05, **P < 0.01, ***P < 0.001, unpaired two-tailed Student’s t test (c, d) and one-way ANOVA (g, h)

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Activation Assay, Transfection, Western Blot, Two Tailed Test

Journal: Cell Death and Differentiation

Article Title: Connexin43 dephosphorylation at serine 282 is associated with connexin43-mediated cardiomyocyte apoptosis

doi: 10.1038/s41418-019-0277-x

Figure Lengend Snippet: Enhanced physical interaction between p38 MAPK and Cx43 in S282A transfected cardiomyocytes and Cx43 S282A+/− hearts. a Representative images of NRVMs transfected with adenovirus and ventricles from WT and Het(2) mice, as indicated, and double-stained with antibodies specific for p38 MAPK (green) and Cx43 (red). The cells indicated with dot irregular shapes and yellow arrows were S282A-negative cells. White arrows point to p38 MAPK colocalized with Cx43 in S282A-positive cell surface and lateral side of the nucleus, and in ventricles of WT and Het(2) mice in enlarged images. Nucleus was stained with Hochest33342, scale bar: 10 μm, n = 3 independent experiments for cell experiment and four hearts for ventricle test in each group. b The quantitative analysis of p38/Cx43 colocalization, represented by Pearson’s correlation coefficient (see Methods), in adenovirus transfected-NRVMs, n = 43–67 cells as indicated, ***P < 0.001, unpaired two-tailed Student’s t test. c Ventricle lysates from WT and Het(2) mice were immunoprecipitated with anti-Cx43 antibody and then Western blotted with anti-p-p38, anti-p38 or anti-FADD antibody, n = 3 independent experiments from 32 mice for each group. d Lysates from vector and Cx43-wt or S282A-transfected cardiomyocytes were immunoprecipitated with anti-Cx43 antibody and then Western blotted with anti-p-p38 or anti-p38 antibody, n = 3 independent experiments for each group

Article Snippet: Antibodies used were as follows: rabbit anti-Fas, anti-N-Cad and anti-cytochrome C (Abcam), rabbit anti-pS282-Cx43 and anti-pS279-Cx43 (Biobyt), rabbit anti-Cox IV, anti-p-p38 MAPK (Thr180/Tyr182), anti-p38 MAPKα, anti-pS368-Cx43, anti-HA, anti-pS262-Cx43 and anti-Cx43 (Santa Cruz), and rabbit anti-ZO-1 (Proteintech), mouse anti-GAPDH and anti-β-actin (ZSGB-BIO), mouse anti-TNFR1, anti-caspase-8 and anti-FADD (Santa Cruz), and goat anti-Cx43 (Acris) and anti-DR5 (Santa Cruz).

Techniques: Transfection, Staining, Two Tailed Test, Immunoprecipitation, Western Blot, Plasmid Preparation

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Active immunization does not affect pTDP-43 levels and TDP-43 cytoplasmic-to-nuclear distribution in rNLS8 mice. Cerebral TDP-43 pathology was analyzed by ELISA, immunohistochemistry, and immunofluorescence stainings in vaccinated rNLS8 mice. A Phospho-TDP-43 (pS409/410) levels were measured in RIPA and urea fractions from neocortex. Only monogenic animals showed statistically significant differences in RIPA lysates (ctrl PBS: p = 7.63*10 –5 , ctrl VAX: p = 7.63*10 –5 ) and urea lysates (ctrl PBS: p = 7.70*10 –5 , ctrl VAX: p = 7.70*10 –5 ) when compared to TDP-PBS group by pairwise Wilcoxon test with Benjamini–Hochberg correction. Mean values are plotted as black dots. B Immunohistochemical staining in the hippocampal region using an antibody against pS409/410 TDP-43. Representative images for each group are shown. Magnified insets are displayed on the top right corner and their position in the overview is depicted by dashed rectangles. Arrows in the inset denote characteristic pTDP-43 inclusions in the CA3 region. Scale bar overview = 500 µm, scale bar inset = 50 µm. C: Immunofluorescence staining of total TDP-43 (human + mouse) in the frontal neocortex. Representative images for each group are depicted in the left panel (Scale bar = 20 µm). Note that control PBS images were taken at a higher gain to compensate for the lower levels of endogenous TDP-43. Right panel shows quantification of the ratios of the cytoplasmic-to-nuclear TDP-43 intensities (after normalization to the ctrl PBS group). Mean values are plotted as black dots. Pairwise t-test with Benjamini–Hochberg correction indicated a statistically significant difference between monogenic ctrl PBS and bigenic TDP-PBS animals ( p = 3.32*10 –5 ). Control (ctrl) PBS n = 6, TDP-PBS n = 6, TDP5 + 7 n = 5, TDP8 + 9 n = 6, TDP10 + 12 n = 5, and TDP15 n = 6

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Enzyme-linked Immunosorbent Assay, Immunohistochemistry, Immunofluorescence, Immunohistochemical staining, Staining, Control

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Epitope scan of TDP-43 reveals differential immunogenicity and safety in mice. Active immunization with 15 different TDP-43 peptides in wild-type C57BL/6J to select the most immunogenic ones for therapeutic vaccination in rNLS8 mice. A Localization and relative size of peptides used for active immunization targeting human TDP-43. Peptide 15 contains pS409/410. NTD: N-terminal domain, NLS: Nuclear localization signal, RRM1/2: RNA recognition motif 1/2. B Immunization regimen for wild-type C57BL/6J mice (age in weeks). Two mice per peptide antigen were immunized monthly (i1-i3) with serum collected before and in between immunizations (b0-b3). C Antibody response towards human recombinant TDP-43 (left panel) or pTDP-43 peptide (pS409/410, right panel) was determined by ELISA after three immunizations. Background-corrected optical density at 450 nm (OD450) was measured in duplicates for each animal (dots) with bars representing mean values. All sera were diluted 1:500. Preimmune serum is analyzed in Fig. S1B. D Experimental groups for therapeutic vaccination. rNLS8 animals expressing hTDP-43ΔNLS were immunized with either pooled antigens or PBS control. Monogenic littermates received either PBS (ctrl PBS) or a mixture of all peptides used for rNLS8 immunization (ctrl VAX). Peptides 1 and 3 were excluded from the control group after discovering side effects in the TDP1 + 3 group (Fig. 1F). E Timeline of immunization and blood sampling in rNLS8 and control mice. After the fifth blood sampling (b5), hTDP-43∆NLS expression was induced by removing doxycycline (DOX) from the chow. All mice were sacrificed 21 days after transgene induction (28.5 weeks of age). F Kaplan–Meier plot showing survival probability of mice during study (humane endpoint). Number of animals at the beginning of the immunization regimen is indicated. Log-rank test and pairwise comparisons with Benjamini–Hochberg correction revealed a statistically significant higher mortality in TDP1 + 3 immunized compared to TDP-PBS control mice (*, p = 0.039). Note that immunization of surviving TDP1 + 3 mice was discontinued after 1, 2 or 3 immunizations ( # , dashed line)

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Recombinant, Enzyme-linked Immunosorbent Assay, Expressing, Control, Sampling

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: C-terminal TDP-43 peptides elicit high-titer antibodies detecting patient TDP-43 aggregates. TDP-43-specific antibody responses in sera from mice receiving five immunizations (expect TDP1 + 3 with 1–3 immunizations) were analyzed by ELISA, immunofluorescence stainings, and immunoblot. A A dilution series of pooled sera was analyzed by ELISA against recombinant full-length TDP-43 (left panel) or pTDP-43 peptide (pS409/410, right panel). Background-corrected mean OD450 was measured in duplicates. Triangular shapes indicate monogenic animals, circles represent rNLS8 mice (labeling consistent throughout the following figures). B Antibody response in antisera from individual mice was measured as in ( A ) in single dilutions (1:500 or 1:20,000) to analyze inter-animal variability. Control (ctrl) PBS n = 17, ctrl VAX n = 18, TDP-PBS n = 10, TDP1 + 3 n = 3, TDP5 + 7 n = 13, TDP8 + 9 n = 13, TDP10 + 12 n = 12, and TDP15 n = 12. Note that the number of immunizations in TDP1 + 3 animals (1, 2 or 3) correlates with the resulting titer. C Double immunofluorescence stainings of pooled antisera and phosphorylated TDP-43 (pS409/410) were performed on frontal cortex sections of a sporadic FTLD case. Representative images are shown. Arrowheads indicate strong (TDP10 + 12, TDP15) or weak (TDP1 + 3, TDP8 + 9) labeling of pTDP-43 inclusions with antisera. TDP5 + 7 antiserum failed to detect pTDP-43-positive inclusions (open arrowhead). Images from a healthy control are shown in Fig. S3A. Scale bar = 10 µm. D Immunoblotting of HEK293 cell lysates of doxycycline-inducible TARDBP knockdown (KD) and control (ctrl) using a commercial TDP-43 antibody (left lane) or pooled antisera. Asterisk denotes a prominent non-specific band detected with the ctrl PBS serum. Calnexin was used as a loading control

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Enzyme-linked Immunosorbent Assay, Immunofluorescence, Western Blot, Recombinant, Labeling, Control, Knockdown

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: TDP-43 active immunization does not prevent weight loss, but the pTDP-43 antigen moderately lowers NfL. Body weight and NfL levels were analyzed in immunized control and rNLS8 mice. A Development of body weight in control and rNLS8 mice before and after transgene induction using doxycycline withdrawal. Mean values are plotted group-wise, n as indicated. The longitudinal effects of treatment (peptide immunization vs. no immunization), genotype (control vs. rNLS8), age as well as their interactions were analyzed using a three-way repeated measures ANOVA. On doxycycline chow, only age had a statistically significant effect on the body weight ( p = 1.99*10 –102 ), but not the treatment ( p = 0.74). After transgene induction, genotype ( p = 0.018), age ( p = 2.34*10 –26 ), and their interaction ( p = 2.20*10 –26 ), but not treatment ( p = 0.901), had a statistically significant effect on the body weight. B Comparison of the percentage body weight (BW) loss from transgene induction (25.5 weeks of age) to end-stage (28.5 weeks of age) against the TDP-PBS group using pairwise t-test with Benjamini–Hochberg correction revealed a statistically significant difference for both monogenic groups (ctrl PBS vs. TDP-PBS: p = 1.47*10 –11 , ctrl VAX vs. TDP-PBS: p = 6.38*10 –10 ) only. Group means are indicated as black dots. C Neurofilament light chain (NfL) levels in the serum of end-stage mice were quantified using the Simoa® platform. Comparisons against TDP-PBS mice using pairwise Wilcoxon test with Benjamini–Hochberg correction revealed a statistically significant difference in NfL levels for ctrl PBS ( p = 8.3*10 –7 ), ctrl VAX ( p = 8.3*10 –7 ), and TDP15 immunized mice ( p = 0.013). Mean values are indicated as black dots

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Control, Comparison

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Profound micro- and astrogliosis in the rNLS8 model are unchanged upon vaccination with TDP-43 peptides. Using an automated staining and analysis pipeline, microglia (Iba1) and astrocyte (GFAP) signals were quantified in hippocampal regions. Representative immunofluorescence images of Iba1 ( A ) or GFAP ( B )-stained hippocampal regions. Magnified insets are shown on the top right corner and their position in the overview is indicated by dashed rectangles. Scale bar overview = 500 µm, scale bar inset = 50 µm. Right panels show automated quantification of the Iba1 ( A ) and GFAP ( B ) cell count per area, followed by normalization to the ctrl PBS group. Mean values are plotted as black dots. Pairwise Wilcoxon test with Benjamini–Hochberg correction revealed an increased Iba1 count in the TDP-PBS group when compared to ctrl PBS animals ( p = 0.011). GFAP counts were analyzed using pairwise t-test with Benjamini–Hochberg correction and were statistically different between TDP-PBS and ctrl PBS mice ( p = 2.04*10 –5 ). None of the vaccinated groups are significantly different from TDP-PBS. Control (ctrl) PBS n = 6, TDP-PBS n = 6, TDP5 + 7 n = 6, TDP8 + 9 n = 6, TDP10 + 12 n = 5, and TDP15 n = 5

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Staining, Immunofluorescence, Cell Counting, Control

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: Antibodies targeting RRM2 and the glycine-rich region of TDP-43 suppress aggregation and LLPS in vitro . A Schematic overview of a panel of novel TDP-43 monoclonal antibodies (mAbs) raised from immunization in Fig. as indicated. The most potent mAbs are highlighted in bold. B Aggregation and condensation assays using recombinant TDP-43-MBP-His 6 . Upon cleavage of the solubilization tag maltose-binding protein (MBP) using TEV protease, soluble TDP-43 forms aggregates ( C ) or condensates ( D / E ), depending on the buffer conditions. Condensates were either analyzed by pelleting ( D ) or by confocal microscopy ( E ). mAbs were added to soluble TDP-43-MBP-His 6 together with TEV protease. C Representative images of Alexa 488-labeled and in vitro aggregated TDP-43, treated with the indicated mAb (molar ratio TDP-43-MBP-His 6 : mAb = 1:2). Images were taken 48 h after TEV cleavage. Clones 30D3 and 31E9 nearly completely prevented aggregation. Overview and magnified insets on the right bottom corner are shown. Scale bar overview = 100 µm, scale bar inset = 50 µm. D Sedimentation assay to analyze condensation of cleaved TDP-43-MBP-His 6 in the presence of mAbs. Supernatant (S) and condensates (C) were separated by centrifugation 2 h after TEV cleavage. Representative immunoblots and quantification of S/(C + S) ratios (bar graphs indicate mean + SD) from four replicates are shown. An asterisk indicates the residual uncleaved TDP-43-MBP-His 6 , the arrowhead marks the cleaved TDP-43 band. mAbs were compared to their respective isotype controls using pairwise t-test with Benjamini–Hochberg correction for multiple testing: IgG2c vs. 30D3: p = 0.017; IgG2c vs. 36C5: p = 3.24*10 –4 ; IgG2c vs. 36C10: p = 0.016; IgG1 vs. 27A3: p = 0.021; IgG1 vs. 31E9: p = 3.87*10 –4 . E Confocal images of Alexa 488-coupled TDP-43-MBP-His 6 and DyLight 650-labeled mAbs show liquid–liquid phase separation of TDP-43 and co-partitioning of mAbs with TDP-43 condensates after TEV protease cleavage. Scale bar = 10 µm

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: In Vitro, Recombinant, Binding Assay, Confocal Microscopy, Labeling, Clone Assay, Sedimentation, Centrifugation, Western Blot

Journal: Acta Neuropathologica Communications

Article Title: Targeting the glycine-rich domain of TDP-43 with antibodies prevents its aggregation in vitro and reduces neurofilament levels in vivo

doi: 10.1186/s40478-023-01592-z

Figure Lengend Snippet: TDP-43 mAbs suppress cellular uptake of recombinant TDP-43 aggregates. A Overview of TDP-43 uptake assay. Aggregation of pHrodo Green-labeled TDP-43-MBP-His 6 was induced by TEV protease cleavage and thorough shaking for 30 min, followed by a 2 h incubation step at room temperature. Preformed aggregates were then incubated with mAbs for 30 min before addition to SH-SY5Y cells. Upon cellular uptake via endocytosis, the pHrodo-tagged aggregates show increased fluorescence in acidic compartments, such as early endosomes (EE), and, even more so, in late endosomes (LE) or lysosomes. After 24 h of incubation, pHrodo fluorescence was analyzed by flow cytometry in the FITC channel. B Representative flow cytometry dot plots showing uptake of pHrodo-TDP-43 agg in combination with different control or TDP-43 specific mAbs in SH-SY5Y cells. Data areshown as relative fluorescence in the FITC channel (x-axis) and side scatter (SSC-A, y-axis). Relevant comparisons are overlaid. Cells were pregated to identify live singlets (not shown). Vertical dotted lines indicate gating for pHrodo + live singlets. C Quantification of TDP-43 aggregate uptake in SH-SY5Y cells, measured as percentage of pHrodo-positive cells of total live single cells. Bar graphs represent mean + SD from n = 3–4 independent experiments. The following comparisons revealed statistically significant differences after pairwise t-test with Benjamini–Hochberg correction: pHrodo-TDP-43 agg + IgG1 ctrl vs. pHrodo-TDP-43 agg + 31E9 (G1): p = 0.037; pHrodo-TDP-43 agg + IgG2c ctrl vs. pHrodo-TDP-43 agg + 36C10 (G2c): p = 0.023; non-treated vs. pHrodo-TDP-43 agg : p = 0.023; pHrodo-TDP-43 mono vs. pHrodo-TDP-43 agg : p = 0.023; TDP-43 agg vs. pHrodo-TDP-43 agg : p = 0.023; pHrodo-TDP-43 agg vs. pHrodo-TDP-43 agg (22 °C): p = 0.023

Article Snippet: The capture antibody was a mouse monoclonal antibody that detects TDP-43 phosphorylated at serines 409/410 (1:500, TIP-PTD-M01, Cosmo Bio, USA), and the detection antibody was a sulfo-tagged rabbit polyclonal C-terminal TDP-43 antibody (2 μg/ml, 12892-1-AP, Proteintech).

Techniques: Recombinant, Labeling, Incubation, Fluorescence, Flow Cytometry, Control

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: Cytosolic mislocalization is a prerequisite for SG recruitment of TDP-43. A, shown is a schematic diagram of TDP-43 wild-type (WT) and NLS mutant (NLSmut). NLSmut, triple point mutation in the classical nuclear localization signal (K83A/R84A/K85A); G-rich, glycine-rich domain; V5, V5 epitope tag. B, C-terminal-V5-tagged TDP-WT or NLSmut were transiently transfected into HeLa cells and 24 h later were subjected to heat shock (44 °C for 1 h), sodium arsenite (0.5 mm for 30 min), or clotrimazole (20 μm for 30 min) treatment or were left untreated (Control). Cells were fixed, stained with a V5 (green) and TIA-1 (red)-specific antibody and a nuclear counterstain (blue), and analyzed by confocal microscopy. Panels to the right show a higher magnification of the boxed region. Although the cytosolic NLS mutant was sequestered into SG, TDP-WT remained nuclear under all stress conditions examined. Scale bars = 20 μm. C, primary rat hippocampal neurons were transiently transfected with V5-tagged TDP-WT or NLSmut. 48 h post-transfection, neurons were subjected to heat shock (44 °C) for 1 h or left untreated (37 °C). Neurons were fixed and stained with a V5-specific antibody (green), a TIA-1-specific antibody (red), and the neuronal marker antibody Tuj1 (white) to visualize neuronal morphology. NLSmut showed partial cytoplasmic mislocalization and was recruited to TIA-1-positive SG upon heat stress. Insets in the upper right corner show a higher magnification of the boxed region. Scale bars, 20 μm.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, Transfection, Staining, Confocal Microscopy, Marker

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: Endogenous TDP-43 is sequestered into heat shock-induced SG upon inhibition of Importin α/β-dependent nuclear import. HeLa cells were transfected with an Importin α/β-specific peptide inhibitor fused to GFP (GFP-Bimax) or GFP as a control (green). 24 h post-transfection cells were subjected to heat shock (44 °C for 1 h) or kept at control temperature (37 °C) before fixation. Cells were co-stained for endogenous TDP-43 (red) and TIA-1 (white) and analyzed by confocal microscopy. Expression of GFP-Bimax resulted in cytosolic mislocalization of endogenous TDP-43 and recruitment into SG upon heat shock. Under control conditions (GFP), TDP-43 was predominantly nuclear and did not colocalize with SG after heat shock. Scale bars = 20 μm.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Inhibition, Transfection, Staining, Confocal Microscopy, Expressing

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: ALS-associated TARDBP mutations do not alter the cellular localization of TDP-43. A, Myc-tagged wild-type TDP-WT or TDP-43 carrying the indicated ALS-associated point mutations (A315T, M337V, or G348C) were transiently transfected into HeLa cells. 24 h post-transfection cells were subjected to heat shock (44 °C for 1 h) or kept at control temperature (37 °C). Afterward cells were fixed, stained with a myc (green) and TIA-1 (red)-specific antibody and a nuclei counterstain (blue), and analyzed by confocal microscopy. Both TDP-WT and the ALS-associated point mutants were nuclear under control conditions and remained nuclear upon heat shock. Scale bars = 20 μm. B, shown are expression levels of TDP-43 constructs used in A. Total cell lysates were analyzed by immunoblotting with a myc-specific antibody (upper panel). Tubulin served as a loading control (lower panel). All lanes were from the same exposure of the same blot. C, quantification of nuclear and cytosolic fluorescence intensities of myc staining at 37 °C is shown. Error bars indicate S.D.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Transfection, Staining, Confocal Microscopy, Expressing, Construct, Western Blot, Fluorescence

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: ALS-associated TARDBP mutations do not affect SG recruitment of cytosolic TDP-43. ALS-associated point mutations (A315T, M337V, G348C) were introduced into the TDP-43 NLS mutant (NLSmutA315T, NLSmutM337V, NLSmutG348C), and the effect of mutations on SG recruitment was analyzed. A, HeLa cells transiently transfected with the indicated TDP-43 constructs were incubated with clotrimazole for 30 min or left untreated (Control). Cells were fixed, stained with a V5 (green) and TIA-1 (red)-specific antibody and a nuclear counterstain (blue), and analyzed by confocal microscopy. ALS-associated point mutations did not affect SG recruitment of cytosolic TDP-43. Scale bars = 20 μm. B, protein levels in total cell lysates were analyzed by immunoblotting with a V5-specific antibody (upper panel), and tubulin served as a loading control (lower panel). The black arrowhead indicates full-length TDP-43, and the white arrowhead indicates caspase-generated 35-kDa CTF frequently observed under transient transfection conditions (61, 75). C, the percentage of TDP-43 localized in TIA-1-positive SG was quantified using ImageJ. 15–20 cells were analyzed in a blinded manner, means across all cells were calculated, and S.D. are indicated by error bars.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, Transfection, Construct, Incubation, Staining, Confocal Microscopy, Western Blot, Generated

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: TDP-43 inclusions in spinal cord but not hippocampus are frequently co-labeled for the SG marker protein PABP-1. TDP-43 immunohistochemistry performed on formalin-fixed, paraffin-embedded tissue sections of spinal cord (upper panels) or hippocampus (lower panels) from FTLD-TDP and ALS-TDP cases is shown. Staining with N-terminal and C-terminal TDP-43-specific antibodies demonstrated labeling of neuronal cytoplasmic inclusions in motor neurons in the spinal cord with both antibodies (ALS case #1 shown), whereas inclusions in dentate granule neurons in the hippocampus were labeled only with the C-terminal antibody (FTLD-TDP case #1 shown). Double-label immunofluorescence stainings of the same cases showed co-labeling of phospho-TDP-43 positive inclusions (green) with the SG marker protein PABP-1 (red) in the spinal cord but not in cortical inclusions. Nuclei were stained with DAPI (blue). Scale bars = 10 μm.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Labeling, Marker, Immunohistochemistry, Formalin-fixed Paraffin-Embedded, Staining, Immunofluorescence

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: 25 kDa C-terminal fragment and a C-terminal deletion mutant of TDP-43 are poorly sequestered into SG. A, shown is a schematic diagram of TDP-43 deletion mutants analyzed for SG recruitment. The deletion mutant Δ1–173 was chosen to mimic the 25-kDa CTF found to be deposited in cortical regions of FTLD-TDP patients (4, 59). The C-terminal deletion mutant (NLSmutΔC) lacks the prion-like glycine-rich domain. B, the indicated TDP-43 constructs were transiently transfected in HeLa cells. Before fixation, cells were treated with clotrimazole (20 μm, 30 min) or left untreated (control). Subsequently, cells were stained with a V5 (green) and TIA-1 (red)-specific antibody and a nuclear counterstain (blue) and analyzed by confocal microscopy. Panels to the right show a higher magnification of the boxed region. In contrast to full-length TDP-NLSmut, both deletion mutants remained predominantly diffuse in the cytosol upon heat shock and were poorly recruited to SG. Scale bars = 20 μm. C, the percentage of TDP-43 localized in TIA-1-positive SG was quantified using ImageJ. 15–20 cells were analyzed in a blinded manner, means across all cells were calculated, and S.D. are indicated by error bars. D, protein levels in total cell lysates were analyzed by immunoblotting with a V5-specific antibody (upper panel); tubulin served as a loading control (lower panel). Black arrowheads indicate full-length TDP-NLSmut or the two deletion mutants, and white arrowheads indicate degradation products. All lanes were from the same exposure of the same blot.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, Construct, Transfection, Staining, Confocal Microscopy, Western Blot

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: The C-terminal deletion mutant of TDP-43 still binds to UG12 RNA. A, TDP-WT was in vitro translated in the presence of [35S]methionine (left lane, Input) and was analyzed for binding to different RNA oligonucleotides immobilized on streptavidin beads (right lanes, UG12, UGUGUGUGUGUGUGUGUGUGUGUG; GGUG, UUGUAUUUUGAGCUAGUUUGGUGAU; CCUC, UUGUAUUUUGAGCUAGUUUCCUCAU). TDP-43 bound to both UG12 and GGUG RNA but not to CCUC RNA). B, the indicated TDP-43 constructs were in vitro translated in the presence of [35S]methionine (upper panel, Input). Biotinylated UG12 RNA or CCUC control RNA were immobilized on streptavidin beads and were used to pull down radioactively labeled proteins (lower panel, Pulldown). TDP-WT and NLSmut as well as the C-terminal deletion mutant NLSmut-ΔC were specifically pulled down by UG12 RNA, whereas the Δ1–173 deletion mutant resembling the 25-kDa CTF did not bind to UG12 RNA.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: Mutagenesis, In Vitro, Binding Assay, Construct, Labeling

Journal: The Journal of Biological Chemistry

Article Title: Requirements for Stress Granule Recruitment of Fused in Sarcoma (FUS) and TAR DNA-binding Protein of 43 kDa (TDP-43) *

doi: 10.1074/jbc.M111.328757

Figure Lengend Snippet: Model of SG recruitment of TDP-43 and FUS. Upon cellular stress, translation of mRNAs is arrested and translationally silent preinitiation complexes that contain mRNA, the small ribosomal subunit (40 S), early initiation factors (e.g. eIF3, eIF4A, eIF4G), and PABP-1 are packaged into SG. We suggest that recruitment of TDP-43 (left) or FUS (right) into SG involves both protein-RNA and protein-protein interactions. TDP-43 and FUS bind to UG-rich mRNA sequences via their main RNA binding domain (RRM1 in TDP-43 and RGG-zinc finger (Z) domain in FUS, respectively) and thus might be recruited into SG via their associated mRNAs. Because additional domains that did not show binding to UG-rich RNA in our RNA binding assay also contribute to SG recruitment of TDP-43 and FUS, we suggest that additional protein-protein interactions with proteins X and Y are involved in SG recruitment of TDP-43 and FUS.

Article Snippet: Sodium (meta)arsenite (Sigma {"type":"entrez-protein","attrs":{"text":"S71287","term_id":"2129650","term_text":"pir||S71287"}} S71287 ) was dissolved in water (100 m m stock) and added to cells at a final concentration of 0.5 m m for 30 min. Antibodies The following antibodies were used: β-actin-specific mouse monoclonal antibody clone AC-74 (Sigma); GFP-specific rabbit polyclonal antibody (BD Living Colors); HA-specific mouse monoclonal antibody HA.11 (Covance); horseradish peroxidase (HRP)-coupled rat monoclonal anti-HA antibody 3F10 (Roche Applied Science); myc-specific mouse monoclonal antibody 9E10 (sc-40, Santa Cruz); PABP-1-specific rabbit polyclonal antibody (Cell Signaling); TDP-43-specific rabbit polyclonal antibody TARDBP (Proteintech); polyclonal antibodies raised against amino acid residues 6–24 of TDP-43 (N-t TDP-43) and amino acid residues 394–414 of TDP-43 (C-t TDP-43) ( 59 ); phosphoserine 409/410-specific TDP-43 rat monoclonal antibody clone 1D3 ( 60 ); TIA-1-specific goat polyclonal antibody (C-20, Santa Cruz); α-tubulin-specific mouse monoclonal antibody clone B-5–1-2 (Sigma); βΙΙΙ-tubulin-specific rabbit polyclonal antibody clone Tuj1 (Sigma); V5-specific mouse monoclonal antibody (R960–25, Invitrogen).

Techniques: RNA Binding Assay, Binding Assay

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Specific binding of anti-T-cadherin antibodies to megakaryocytes MEG-01 and platelets compared with negative THP-1 control and positive human umbilical vein endothelial cells (HUVEC) control according to flow cytometry data. Forward scatter /Side scatter gates were cell specific and channel voltage for detection of T-cadherin (ex640 em670/14) was the same for all cells (THP-1, HUVEC, MEG-01) and different for platelets. ( a ) Distribution histograms of cells incubated with antibodies anti-T-cadherin (blue) or isotypic control (red). ( b ) Median and percentiles of the fluorescence (antibody binding) for the above histograms. * The binding of the specific antibody is greater than of the isotype control, p < 0.001. n = 5. ( c ) Median and percentiles of the fluorescence (antibody binding) for blank sample without antibody (Bl), sample with rabbit IgG (IG_R), ProSci (PS), SantaCruz (SC), and Abnova (Ab) antibodies. * The binding of the specific antibody is greater than of the isotype control, p < 0.001. n = 2.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Binding Assay, Flow Cytometry, Incubation, Fluorescence

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Validation of antibody #BAF3264. Fixed cells. Hoechst 33342 (DNA)—blue, #BAF3264 (T-cadherin)—red: ( a ) Wild-type CHO; ( b ) CHO cells with T-cadherin expression. Scale bar (red line) 10 µm.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Expressing

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Representative confocal microscopy image (a single focal plane) of T-cadherin on platelets. CD61—green, T-cadherin—red, DNA (Hoecst 33342)—blue. Live platelet and nucleated blood cells. Scale bar (white line) 2 µm.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Confocal Microscopy

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Digestion with phosphatidylinositol-specific phospholipase C (PI-PLC) decreases binding of the specific antibody against T-cadherin to platelets ( a ) and MEG-01 ( b ). Platelets are identified by their FSC/SSC characteristic (the first gate) and positive CD61 labeling (the second gate), MEG-01 cells are identified by the other FSC/SSC gate. Right histograms show fluorescence from the binding of the anti-T-cadherin antibody before (blue) and after (red) PI-PLC treatment and from the isotypic control (gray).

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Binding Assay, Labeling, Fluorescence

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Representative immunoblots against T-cadherin with platelet and positive controls lysates with protein bands standards, n = 5. ( a ) First three lanes were incubated with R&D #AF3264 antibodies, last three lanes were incubated with ProSci #3583 antibodies, H–HUVEC, pl1, pl2—platelets from different donors, HT–HEK293 overexpressing T-cadherin (preparation describe in ) (film), ( b ) H–HUVEC, pl—immunoprecipitate of the platelet lysate (R&D #AF3264, multichannel digital detection).

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Western Blot, Incubation

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: Analysis of fractions after ultracentrifugation of platelet lysates with the Triton X-114 detergent. 1–12—the fractions obtained after ultracentrifugation. Upper panel—immunoblotting of the obtained fractions with antibodies against T-cadherin. The middle panel shows the total amount of protein in the fractions, analyzed using amide black. The lower panel shows the ratio of the T-cadherin signal intensity measured by immunoblotting to the total protein amount in the fractions, arbitrary units.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Western Blot

Journal: Membranes

Article Title: The Missing Protein: Is T-Cadherin a Previously Unknown GPI-Anchored Receptor on Platelets?

doi: 10.3390/membranes11030218

Figure Lengend Snippet: The confocal microscopy images and orthogonal view of Z-stack of resting and activated platelets. CD61—green, T-cadherin—red. Plots of fluorescence intensity along the cross-section line from ( a , b ), respectively. ( a ) Fixed resting human platelets—non-permeabilized (left) and permeabilized (right); ( b ) fixed and permeabilized activated human platelet; ( c ) live activated human platelet. Scale bar (white line) 2 µm.

Article Snippet: It is interesting to note that other antibodies (ProSci, 3583; Santa Cruz 7940) against the first domains of T-cadherin were hardly bound with platelets at all, and the signal was no higher than that from the isotype control ( c).

Techniques: Confocal Microscopy, Fluorescence

Journal: Molecular Medicine Reports

Article Title: Role and mechanism of Twist1 in modulating the chemosensitivity of FaDu cells

doi: 10.3892/mmr.2014.2212

Figure Lengend Snippet: Twist1 and MDR1 were elevated in a MDR dose-dependent manner. (A) Twist1 and MDR1 were elevated in FaDu/T cells compared with FaDu cells. In high-fold resistant cells, Twist1 and MDR1 were elevated higher, which suggested that Twist1 and MDR1 changed in a MDR dose-dependent manner during MDR. (B) Image J software analysis shows that the significance of MDR1 change can be detected from FaDu/T-80 nM cells ( * P<0.05 vs. FaDu cells). MDR, multidrug resistance.

Article Snippet: The human hypopharyngeal carcinoma cell line FaDu was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

Techniques: Software

Journal: Molecular Medicine Reports

Article Title: Role and mechanism of Twist1 in modulating the chemosensitivity of FaDu cells

doi: 10.3892/mmr.2014.2212

Figure Lengend Snippet: Morphological observation and detection of apoptosis-related proteins by western blot analysis. (A) AO staining and Ho.33342/PI double staining exhibited the anti-apoptosis of FaDu/T cells. (B) Cleaved caspase-3, caspase-9, Bcl-2 and Bax all changed to resist apoptosis during MDR progress. MDR, multidrug resistance; AO, acridine orange.

Article Snippet: The human hypopharyngeal carcinoma cell line FaDu was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

Techniques: Western Blot, Staining, Double Staining

Journal: Molecular Medicine Reports

Article Title: Role and mechanism of Twist1 in modulating the chemosensitivity of FaDu cells

doi: 10.3892/mmr.2014.2212

Figure Lengend Snippet: Establishment and determination of stable cell lines expressing Twist1 cDNA and Twist1 miRNA of FaDu cells. (A) Western blot analysis determination of Twist1 expression level. (B) Semi-quantitative assay of Twist1 based on Image J software analysis. (C) mRNA level of Twist1 in FaDu, negative control cells (Vector) and FaDu-Twist1-miRNA cells (Twist1−). (D) Protein level of Twist1 in FaDu, negative control cells (Vector) and FaDu-Twist1-miRNA cells (Twist1−).

Article Snippet: The human hypopharyngeal carcinoma cell line FaDu was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

Techniques: Stable Transfection, Expressing, Western Blot, Software, Negative Control, Plasmid Preparation

Journal: Molecular Medicine Reports

Article Title: Role and mechanism of Twist1 in modulating the chemosensitivity of FaDu cells

doi: 10.3892/mmr.2014.2212

Figure Lengend Snippet: Twist1 expression detection by laser scanning confocal microscopy. DAPI was used to mark nuclei and TRITC was employed to indicate Twist1. Under the same intensity, FaDu-Twist1+ cells (Twist1+) expressed more Twist1 protein compared with FaDu cells. Reversely, FaDu-Twist1-miRNA cells (Twist1−) expressed less.

Article Snippet: The human hypopharyngeal carcinoma cell line FaDu was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

Techniques: Expressing, Confocal Microscopy

Journal: Molecular Medicine Reports

Article Title: Role and mechanism of Twist1 in modulating the chemosensitivity of FaDu cells

doi: 10.3892/mmr.2014.2212

Figure Lengend Snippet: Chemosensitivity and MDR1 changes with expression of Twist1. (A and B) MDR1 increased in FaDu-Twist1+ cells (Twist1+) and decreased in FaDu-Twist1-miRNA cells (Twist1−), compared with FaDu and negative control cells (Vector). (C) IC 50 was applied to chemo-drug sensitivity of cells with different Twist1 expressions. * P<0.05 vs. FaDu cells. MDR, multidrug resistance.

Article Snippet: The human hypopharyngeal carcinoma cell line FaDu was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

Techniques: Expressing, Negative Control, Plasmid Preparation

Journal: Molecular Medicine Reports

Article Title: Role and mechanism of Twist1 in modulating the chemosensitivity of FaDu cells

doi: 10.3892/mmr.2014.2212

Figure Lengend Snippet: Apoptosis-related proteins assayed by western blot analysis and Ca 2+ concentrations analyzed by flow cytometry with expression of Twist1. (A and B) Cleaved caspase-3, caspase-9, Bcl-2 and Bax changed accordingly to resist apoptosis in FaDu/Twist1+ cells (Twist1+), and changed reversely in FaDu/Twist1-miRNA cells (Twist1−) to accelerate apoptosis, compared with FaDu, FaDu cells with negative control vector (Vector). (C and D) Ca 2+ concentrations analyzed in different cell lines. A significant difference could be found with the expression of Twist1 (P<0.05).

Article Snippet: The human hypopharyngeal carcinoma cell line FaDu was obtained from the American Type Culture Collection (ATCC; Manassas, VA, USA).

Techniques: Western Blot, Flow Cytometry, Expressing, Negative Control, Plasmid Preparation

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 decreases ubiquitination of Cx43 in rats exposed to CUS. The tissue lysates immunopreciptated using normal rabbit IgG or rabbit antibody against total Cx43 (IP: Cx43). The immune complexes immunoblotted using an antibody against ubiquitin (IB: Ubiquitin). The blots from three independent experiments were subjected to densitometric analyses for ubiquitinated Cx43 and the results were expressed as the density of the bands in the test sample relative to those in the vehicle sample. n = 3 per group. ** p < 0.01, compared with the vehicle group; # p < 0.05, compared with the CUS group. Cx43, connexin 43.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Ubiquitin Proteomics

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 decreases ubiquitinated Cx43 in CUS-treated rats. The confocal microscopy images showed double-stained with antibodies against Cx43 (green) and ubiquitin (red). Nuclei are stained with DAPI. Scale bar = 150 μm. n = 3 per group. ** p < 0.01, compared with the vehicle group; # p < 0.05, compared with the CUS group. Ubi, ubiquitin.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Confocal Microscopy, Staining, Ubiquitin Proteomics

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 suppresses the increased Cx43 ubiquitin degradation in LPS-induced glial cells. The cell lysates were subjected to immunoprecipitation with anti-Cx43 antibody (IP: Cx43) or normal IgG. The resultant precipitates were then subjected to western blot using anti-ubiquitin antibody (IB: Ubiquitin). Quantification of the ubiquitinated Cx43 was expressed as percentages of the control values. n = 3. ** p < 0.01, compared with the Ctrl group; # p < 0.01, compared with the LPS group.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Ubiquitin Proteomics, Immunoprecipitation, Western Blot, Control

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Rg1 reduces ubiquitinated Cx43 in LPS-treated glial cells. The confocal microscopy images showed double-stained with antibodies against Cx43 (green) and ubiquitin (red). Nuclei were labeled with blue. Scale bar = 150 μm. n = 3. ** p < 0.01, compared with the Ctrl group; # p < 0.05, compared with the LPS group.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Confocal Microscopy, Staining, Ubiquitin Proteomics, Labeling

Journal: Frontiers in Pharmacology

Article Title: Ginsenoside Rg1 Ameliorates Neuroinflammation via Suppression of Connexin43 Ubiquitination to Attenuate Depression

doi: 10.3389/fphar.2021.709019

Figure Lengend Snippet: Schematic illustration of the signaling pathway involved in the anti-inflammatory and anti-depressant actions of Rg1 on Cx43 ubiquitination. Stresses, such as CUS or LPS treatment upregulates pro-inflammatory cytokines activation, which in turn aggravates depression. Rg1 may ameliorate neuroinflammation via suppression of Cx43 ubiquitination to attenuate depression.

Article Snippet: Additional antibody sources: mouse β -actin, normal rabbit IgG, rabbit Cx43, mouse Cx43, rabbit ubiquitin, and mouse ubiquitin antibodies were obtained from Cell Signaling Technology (Beverly, MA, United States); Alexa Fluor-488 donkey anti-mouse and 546 donkey anti-rabbit secondary antibodies were produced by Invitrogen (Carlsbad, CA, United States).

Techniques: Ubiquitin Proteomics, Activation Assay

Journal: bioRxiv

Article Title: Acute adenoviral cardiac infection elicits an arrhythmogenic substrate prior to inflammatory myocardial remodeling and myocarditis

doi: 10.1101/2022.11.29.518421

Figure Lengend Snippet: Mice were infected intranasally with 5×10 5 i.u. MAdV-3 or saline (mock) and cardiac tissue was harvested 7 d.p.i. for analyses. A) RT-qPCR of heart tissue mRNA for major cardiac gap junction genes Gja1, Gjc1 , and Gja5 . B) Confocal immunofluorescence microscopy from cryosections to detect Cx43 (green) and N-cadherin (red), with quantification of fluorescent intensity line scans across intercalated discs on right (scale bar: 50 μm). C) Western blotting of cardiac ventricle tissue probed for Cx43, with GAPDH as loading control to normalize quantitation on right. D) Western blotting of cardiac ventricle tissue probed for phospho-Cx43 Ser368 with quantification normalized to total Cx43 on right. *p ≤ 0.05, **p ≤ 0.01, student’s t-test. Data are represented as mean ± SEM.

Article Snippet: Primary antibodies were incubated overnight at 4 °C utilizing: rabbit anti-Cx43 (1:3,000; Sigma-Aldrich), mouse anti-GAPDH (1:2,000; Santa Cruz Biotechnology), and rabbit anti-phospho-Cx43 Ser368 [D6W8P] (1:1,000; Cell Signaling Technology).

Techniques: Infection, Saline, Quantitative RT-PCR, Immunofluorescence, Microscopy, Western Blot, Control, Quantitation Assay

Journal: bioRxiv

Article Title: Acute adenoviral cardiac infection elicits an arrhythmogenic substrate prior to inflammatory myocardial remodeling and myocarditis

doi: 10.1101/2022.11.29.518421

Figure Lengend Snippet: HiPSC-CMs were infected with HAdV-LacZ or HAdV-5 at an MOI 10 and harvested 24 h.p.i. A) Western blotting of cells probed for phospho-Cx43 Ser368 with quantification normalized to total Cx43 on right (n=3). B) Confocal immunofluorescence microscopy from fixed HiPSC-CMs to detect nuclei (blue) and Human Adenoviral protein E1A (red) (scale bar: 25 μm). C) Live-cell confocal microscopy 24 h.p.i. using Fluo-4 AM to measure Ca 2+ transients and quantification of fluorescence signaling over time in one field of view (scale bar: 25 μm). D) Average peak-to-peak fluorescence intensity variance measured per cell over time (n=9). *p ≤ 0.05, **p 0.01, student’s t-test. Data are represented as mean ± SEM.

Article Snippet: Primary antibodies were incubated overnight at 4 °C utilizing: rabbit anti-Cx43 (1:3,000; Sigma-Aldrich), mouse anti-GAPDH (1:2,000; Santa Cruz Biotechnology), and rabbit anti-phospho-Cx43 Ser368 [D6W8P] (1:1,000; Cell Signaling Technology).

Techniques: Infection, Western Blot, Immunofluorescence, Microscopy, Confocal Microscopy, Fluorescence

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: Identification of conserved sequence features in the TDP43 CTD. ( A ) TDP43 domain overview and disorder prediction. TDP43 is comprised of a folded N-terminal domain (NTD), two folded folded RNA-recognition motifs (RRM 1&2) and disorder-containing C-terminal domain (CTD) featuring a highly conserved region (CR). Disorder predictions are based on DisoPred (bioinf.cs.ucl.ac.uk/psipred) analysis for human TDP43 (UniProtKB Q13148). ( B ) Primary amino acid sequence of the human TDP43 CTD. Disordered regions are in capital and the CR in lower-case letters. Hydrophobic motifs are highlighted in bold orange, negatively-charged residues in blue and positively-charged residues in red. ( C ) Violin plots of the sequence divergence (represented as normalized Levenshtein distance per 100 aa) between the NTDs, RRMs and CTDs of 99 vertebrate TDP43 homologs. The plots show two clusters each, corresponding to fish and tetrapod TDP43 homologs. The numbers below the plots represent the median sequence changes in the entire dataset for the tetrapod cluster only (in parenthesis). ( D ) Amino acid composition of the intrinsically disordered regions (IDRs) and conserved regions (CRs) that comprise the TDP43 CTD. ( E ) Density distribution of the conserved hydrophobic residues (V, L, I, M, F, Y, W) in the IDRs of the TDP43 CTD. ( F ) Comparison of the hydrophobicity distribution across the vertebrate TDP43 CTD dataset. Hydrophobicity was calculated in a sliding window of 5 amino acids on the scale of Fauchère and Pliska (black trace: human CTD; light blue area: deviation amongst CTD homologs; sequence snippets: major hydrophobic windows).

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Sequencing

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: Aromatic residues and π-interactions are crucial drivers of TDP43 phase separation. ( A ) TDP43 RRM-GFP reporter constructs carrying the indicated mutations were transiently transfected into HEK-293T cells and analyzed by high-throughput automated confocal microscopy and flow cytometry. Top row: hydrophobicity plots for each CTD, with numbers highlighting the major hydrophobic clusters. Middle row: representative confocal images (63x) of cells transfected with various TDP43 RRM-GFP constructs. Blue outline demarcates nuclei; Set1 and Set2 indicate two different sets of photomultiplier settings used for optimal display only. Bottom rows: quantification of nuclear TDP43 RRM-GFP levels in cells with (‘Cond’) or without (‘Diff’) condensates measured by confocal images (20X) and total TDP43 RRM-GFP levels measured by flow cytometry. Data is presented as violin plots, with color-coding representing the probability density of cells in a particular fluorescence bin. Numbers and percentages below each graph reflect the absolute and relative number of transfected cells with (Cond) or without (Diff) TDP43 RRM-GFP condensates, respectively. For cells without condensates, percentages within in each graph reflect the number of cells with nuclear TDP43 fluorescence above the estimated critical concentration for phase separation. For total TDP43 RRM-GFP levels (bottom row), “Rel. Tot.” denotes the overall median cellular abundance of each CTD variant relative to the WT (n ≥ 10,000 cells). Dashed blue lines indicate the C sat of WT TDP43 RRM-GFP (C sat ) or the median total abundance of WT TDP43 RRM-GFP (WT), respectively. ( B ) and ( C ) Half-bleach FRAP experiments to determine the impact of the indicated CTD mutations on the dynamics of TDP43 RRM-GFP droplets in transiently-transfected HEK-293T cells. Plots show time-dependent, normalized fluorescence recovery. Plot markers represent mean values and error bars standard deviation (n ≥ 7).

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Construct, Transfection, High Throughput Screening Assay, Confocal Microscopy, Flow Cytometry, Fluorescence, Concentration Assay, Variant Assay, Standard Deviation

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: The spacing of hydrophobic residues across the CTD dictates the material properties of TDP43 RRM-GFP condensates. ( A ) Hydropathy plots (with numbers denoting hydrophobic peaks), cellular distribution, nuclear abundance and total cellular abundance of TDP43 RRM-GFP variants with altered spacing between hydrophobic peaks. Data is represented as in (n ≥ 2,400 and 10,000 cells for nuclear and total GFP levels, respectively). See Fig. S2 for an illustration of how the mutants were constructed by sliding hydrophobic clusters. ( B ) Material properties of condensates formed by TDP43 RRM-GFP variants probed by half-bleach FRAP (as in and ). Plot markers represent mean values and error bars standard deviation (n ≥ 5).

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Construct, Standard Deviation

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: Compensatory second-site mutations can rescue altered phase dynamics caused by primary mutations. ( A ) Plots showing the effects of single and double point mutations on local hydrophobicity in the TDP43 CTD. ( B and C ) Material properties of TDP43 RRM-GFP droplets with single and double CTD mutations formed by transient transfection in HEK-293T cells. Plot markers represent mean values and error bars standard deviation (n ≥ 10).

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Transfection, Standard Deviation

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: Aromatic residues in the CTD are important for the localization of full-length TDP43 to nuclear bodies. Hydropathy plots ( A ), nuclear distribution ( B , C ) and total cellular abundance ( D ) of full-length, GFP-tagged TDP43 (GFP-TDP43) variants with the indicated CTD mutations expressed by stable transduction in TDP43-/- HEK-293T cells. ( B ) Representative images of the nuclear distribution of each variant. ( C ) Percentage of cells showing nuclear foci (“Foci”) or a purely diffuse nuclear distribution (“Diff”); n ≥ 150 cells. ( D ) Distribution of total cellular GFP-TDP43 measured by flow cytometry and depicted as in (n ≥ 150,000 cells). “Rel. Tot.” denotes the overall median cellular abundance of each GFP-TDP43 variant relative to the WT.

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Transduction, Variant Assay, Flow Cytometry

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: Mutations that alter phase separation can still support TDP43-mediated skipping of a model exon in a single-cell splicing reporter. ( A ) Splicing reporter design. Production of a dually-fluorescent GFP-mCherry fusion protein depends on the presence of functional full-length TDP43 to mediate skipping of exon 2 (“E2”, derived from the TDP43-regulated exon 9 of the CFTR gene). TDP43 and its CTD variants are expressed as fusions to BFP, which is post-translationally cleaved due to an intervening P2A site. The BFP-P2A-TDP43 and the GFP-mCherry splicing reporter are expressed from the same plasmid via a bi-directional promoter by transient transfection in TDP43-/- HEK- 293T cells. ( B ) Splicing efficiency of the indicated TDP43 compositional mutants quantitatively measured on a single-cell level by flow cytometry and expressed as the log of the mCherry/GFPxBFP ratio per cell. The grey vertical line indicates the median ratio for WT TDP43. ( C ) Exon skipping activity of TDP43 variants measured by RT-PCR using primers spanning exon 2 (see cartoon below the gel). Diagrams to the left denote the electrophoretic positions of the various splicing intermediates and products.

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Functional Assay, Derivative Assay, Plasmid Preparation, Transfection, Flow Cytometry, Activity Assay, Reverse Transcription Polymerase Chain Reaction

Journal: bioRxiv

Article Title: Decoding and recoding phase behavior of TDP43 reveals that phase separation is not required for splicing function

doi: 10.1101/548339

Figure Lengend Snippet: Mutations that alter phase separation can still support TDP43-mediated skipping of cryptic exons in endogenous genes. Splicing of cryptic exons in ATG4B, DNAJC5 and ITPR3 known to be regulated by TDP43 was assessed in WT, TDP43-/-, or TDP43-/- HEK-293T cells stably expressing the indicated variants of GFP-TDP43. See for characterization of these cell lines, including assessment of total cellular GFP-TDP43 abundance by flow cytometry. Left cartoons show the position of the TDP43 binding site relative to the cryptic exon in each gene. Primers aligning to exons flanking the cryptic exon were used in RT-PCR (gel on right) to assess the relative abundance of the mRNA species that either retained or excluded the cryptic exon. The expected PCR products for the correctly spliced transcripts are marked to the left of the gels.

Article Snippet: To generate the stable HEK-293T cell lines specified in the Key Resources Table, the indicated GFP-TDP43 CTD variants were cloned into pLenti-CMV Puro DEST (Addgene #17452; ( )) and transfected into HEK-293T cells together with pMD2.G (Addgene #12259) and psPAX2 (Addgene #12260) to produce lentiviral particles for transduction.

Techniques: Stable Transfection, Expressing, Flow Cytometry, Binding Assay, Reverse Transcription Polymerase Chain Reaction

Journal: bioRxiv

Article Title: Pathological TDP-43 filaments accumulate at synapses and cause synaptic dysfunction

doi: 10.64898/2026.01.27.701787

Figure Lengend Snippet: A. Schematic summarising the extraction of TDP-43 filaments and their incubation with neuronal cultures. B. Immunogold negative-stain electron microscopy of extracted TDP-43 filaments from FTLD-TDP Type A patient brain, using a primary antibody against the N-terminus of TDP-43 and a secondary antibody conjugated to 10 nm gold particles. Scale bar, 100 nm. C. Immunoblot of extraction fractions and the final TDP-43 filament sample from FTLD-TDP Type A patient brain, probed with an antibody against pS409/410 TDP-43 (pTDP-43). The arrow indicates full-length (FL) TDP-43 and the bar indicates C-terminal fragments (CTFs) of TDP-43. D. Immunofluorescence confocal microscopy images of mouse primary cortical neurons incubated with (+ filaments) or without (- filaments) FTLD-TDP Type A patient-derived TDP-43 filaments for 7 d. Neurons were labelled using an antibody against class III β-tubulin (βIII-Tub; cyan) and TDP-43 filaments were labelled using the antibody against pTDP-43 (magenta). E. pTDP-43 signal (white) within images masked using the βIII-tubulin signal (yellow). Signal of 0.05-3 μm 2 is shown in cyan. This size filter was used to exclude noise and large extracellular TDP-43 filament accumulations from quantification in (F) . Scale bar, 20 µm. F. Quantification of βIII-tubulin-masked pTDP-43 signal from (E) at different timepoints. The total area of pTDP-43 signal as a percentage of the βIII-tubulin signal mask is plotted. Each data point represents one technical repeat. Data points are colour coded by biological replicate. n = 3 biological replicates. Means +/- SD are shown. A one-way ANOVA with Tukey’s multiple comparison test was performed, ***p<0.001, ****p<0.0001. G. Immunofluorescence confocal microscopy images of mouse primary cortical neurons incubated with FTLD-TDP Type A patient brain-derived TDP-43 filaments for 1 d. TDP-43 filaments were labelled with the antibody against pTDP-43 pre- (yellow) and post- (magenta) detergent permeabilisation. Neurons were labelled with an antibody against class III β-tubulin (βIII-Tub; cyan). Arrows indicate examples of pTDP-43 signal unique to permeabilised neurons. H. pTDP-43 signal (white) within images masked using the βIII-tubulin signal (yellow). Signal of 0.05-3 μm 2 shown in cyan. This size filter was used to exclude noise and large extracellular TDP-43 filament accumulations from quantification in (I) . Scale bars, 5 and 10 μm, as indicated. I. Quantification of βIII-tubulin-masked pTDP-43 signal pre- and post-permeabilisation from (H) . The total area of pTDP-43 signal as a percentage of the βIII-tubulin signal mask is plotted. Each pair of data points represent one technical repeat. n = 3 biological replicates. A paired t-test was performed, **p<0.01.

Article Snippet: The grids were then blotted and incubated with anti-TDP-43 primary antibody (Proteintech, 10782-2-AP; 1:25) diluted in blocking buffer for 3 h at 21°C.

Techniques: Extraction, Incubation, Staining, Electron Microscopy, Western Blot, Immunofluorescence, Confocal Microscopy, Derivative Assay, Comparison

Journal: bioRxiv

Article Title: Pathological TDP-43 filaments accumulate at synapses and cause synaptic dysfunction

doi: 10.64898/2026.01.27.701787

Figure Lengend Snippet: A. Schematic summarising the antibody-targeted proximity labelling strategy. TDP-43 filaments (red) were targeted using a primary antibody against pS409/410 TDP-43 (magenta). Horseradish peroxidase (grey) conjugated to a secondary antibody (green) was then used to catalyse the conversion of biotin-phenol to biotin-phenoxyl radicals (yellow) in the presence of hydrogen peroxide, thereby biotinylating proximal biomolecules. B. Immunofluorescence confocal microscopy images of mouse primary cortical neurons incubated with (+ filaments) or without (- filaments) FTLD-TDP Type A patient brain-derived TDP-43 filaments for 1 d, followed by antibody-targeted proximity labelling. TDP-43 filaments were labelled using an antibody against pS409/410 TDP-43 (pTDP-43; magenta), biotin was labelled using fluorescence-conjugated streptavidin (yellow) and neurons were labelled with an antibody against class III β-tubulin (βIII-Tub; cyan). Scale bars, 10 μm. C. Immunoblots of affinity purified biotinylated proteins from mouse primary cortical neurons (beads, b) and the flowthrough (f), probed with antibodies against biotin (left) and TDP-43 (right). Neurons were incubated with (+ filaments) or without (- filaments) FTLD-TDP Type A patient brain-derived TDP-43 filaments, in the presence or absence (- antibody) of the antibody against pTDP-43, followed by antibody-targeted proximity labelling.

Article Snippet: The grids were then blotted and incubated with anti-TDP-43 primary antibody (Proteintech, 10782-2-AP; 1:25) diluted in blocking buffer for 3 h at 21°C.

Techniques: Immunofluorescence, Confocal Microscopy, Incubation, Derivative Assay, Fluorescence, Western Blot, Affinity Purification

Journal: bioRxiv

Article Title: Pathological TDP-43 filaments accumulate at synapses and cause synaptic dysfunction

doi: 10.64898/2026.01.27.701787

Figure Lengend Snippet: A. Venn diagrams of the number of significantly-enriched proximal proteins from mouse primary cortical neurons and human ESC-derived cortical neurons incubated with FTLD-TDP Type A patient-brain derived TDP-43 filaments for 1 d and 3 d. B. Bar plot of numbers of significantly-enriched Gene Ontology (GO) Biological Process terms for proximal proteins from mouse primary cortical neurons and human ESC-derived cortical neurons incubated with FTLD-TDP Type A patient-brain derived TDP-43 filaments for 1 d and 3 d. C. Schematic summarising the significantly-enriched GO Cellular Compartment terms (red) for mouse primary cortical neurons and human ESC-derived cortical neurons incubated with FTLD-TDP Type A patient-brain derived TDP-43 filaments for 1 d and 3 d. D. Representative significantly-enriched proximal proteins from mouse primary cortical neurons and human ESC-derived cortical neurons incubated with FTLD-TDP Type A patient-brain derived TDP-43 filaments for 1 d and 3 d.

Article Snippet: The grids were then blotted and incubated with anti-TDP-43 primary antibody (Proteintech, 10782-2-AP; 1:25) diluted in blocking buffer for 3 h at 21°C.

Techniques: Derivative Assay, Incubation

Journal: bioRxiv

Article Title: Pathological TDP-43 filaments accumulate at synapses and cause synaptic dysfunction

doi: 10.64898/2026.01.27.701787

Figure Lengend Snippet: A. Representative significantly-enriched proximal pre- and postsynaptic proteins from mouse primary cortical neurons and human ESC-derived cortical neurons incubated with FTLD-TDP Type A patient-brain derived TDP-43 filaments for 1 d and 3 d. Presynaptic active zone complex proteins are highlighted in red. B. Immunofluorescence Airyscan confocal microscopy images of mouse primary cortical neurons incubated with FTLD-TDP Type A patient-derived TDP-43 filaments for 3 d. Neurons were labelled using antibodies against microtubule-associated protein 2 (MAP2; grey); the presynaptic active zone complex protein bassoon (yellow); and PSD95 (cyan). TDP-43 filaments were labelled using the antibody against pTDP-43 (magenta). The arrow indicates an example of pTDP-43 signal colocalising with bassoon. Scale bars, 5 µm and 1 µm, as indicated. C. Percentage of MAP2-masked pTDP-43 signal colocalised with bassoon (left) and PSD95 (right), and vice versa, from (C) in three-dimensional space. Each data point represents one technical replicate. n= 2 biological replicates. Means +/- SD are shown.

Article Snippet: The grids were then blotted and incubated with anti-TDP-43 primary antibody (Proteintech, 10782-2-AP; 1:25) diluted in blocking buffer for 3 h at 21°C.

Techniques: Derivative Assay, Incubation, Immunofluorescence, Confocal Microscopy

Journal: bioRxiv

Article Title: Pathological TDP-43 filaments accumulate at synapses and cause synaptic dysfunction

doi: 10.64898/2026.01.27.701787

Figure Lengend Snippet: A. Immunoblot of synaptosome isolation fractions (s, supernatant; cp, cell pellet; cyt, cytosolic; syn, synaptosomes) from mouse primary cortical neurons incubated with (+ filaments) and without (- filaments) FTLD-TDP Type A patient brain-derived TDP-43 filaments for 3 d, probed with antibodies against postsynaptic density protein 95 (PSD95, top), pS409/410 TDP-43 (pTDP-43, middle) and TDP-43 (bottom). The arrows indicate full-length (FL) TDP-43 and C-terminal fragments (CTFs) of TDP-43. B. Denoised tomographic slices of synaptosomes from mouse primary cortical neurons incubated with FTLD-TDP Type A patient brain-derived TDP-43 filaments for 3 d. TDP-43 filaments (magenta arrows), example synaptic vesicles (cyan arrows) and the postsynaptic density (yellow arrow) are indicated. C and D. Denoised tomographic slices showing TDP-43 filaments (magenta arrows). making contacts (green arrows) with synaptic vesicles (cyan arrows) (C) and the presynaptic plasma membrane (yellow arrows) (D) . B-D. Scale bars, 50 nm.

Article Snippet: The grids were then blotted and incubated with anti-TDP-43 primary antibody (Proteintech, 10782-2-AP; 1:25) diluted in blocking buffer for 3 h at 21°C.

Techniques: Western Blot, Isolation, Incubation, Derivative Assay, Clinical Proteomics, Membrane

Journal: bioRxiv

Article Title: Pathological TDP-43 filaments accumulate at synapses and cause synaptic dysfunction

doi: 10.64898/2026.01.27.701787

Figure Lengend Snippet: A. Representative false-coloured images of mouse primary cortical neurons expressing SypHy prior to stimulation (Rest), during stimulation with a train of 300 action potentials delivered at 10 Hz (10 Hz), following stimulation (Recovery) and during challenge with ammonium chloride (NH 4 ) buffer to reveal the total synaptic vesicle pool. Arrows indicate examples of terminals that respond to stimulation. Scale bar, 2 μm. B. Time course of relative SypHy fluorescence intensity (ΔF/F0) in mouse primary cortical neurons incubated with FTLD-TDP Type A patient brain-derived TDP-43 filaments (+ filaments) or with aged-matched control brain extracts (+ control) for 3 d, normalised to challenge with NH 4 buffer (total synaptic vesicle pool). The bar indicates the period of stimulation. n = 4 biological replicates. Means +/- SEM are shown. C. Rate of activity-dependent relative SypHy fluorescence increase (ΔF/F0) over the first 6 seconds of stimulation (stimulation triggered at 30 s). n = 4 biological replicates. Means +/- SEM are shown. Linear regression analysis was performed (lines), **p=0.0055. D. Representative traces of excitatory postsynaptic currents (EPSCs) evoked by paired presynaptic stimuli (50 ms interval) from mouse primary hippocampal neurons incubated with (+ filaments) or without (- filaments) FTLD-TDP Type A patient brain-derived TDP-43 filaments or with aged-matched control brain extracts (+ control) for 7 d. E. Plot of the ratios of the second to the first EPSC (paired-pulse ratio; PPR) from mouse primary hippocampal neurons incubated with (+ filaments) or without (- filaments) FTLD-TDP Type A patient brain-derived TDP-43 filaments or aged-matched control brain extracts (+ control) for 3-4 d (d3/4) and 6-7 d (d6/7). Each data point represents one paired recording. Data points are colour coded by biological replicate. n = 3 biological replicates. Means +/- SD are shown. A two-way ANOVA with Tukey’s multiple comparison test was performed, *p<0.05, ****p<0.0001. F. Widefield fluorescence microscopy images of mouse primary cortical neurons expressing the fluorescent calcium indicator jRGECO1a (red) over 1200 ms. Images were taken at 100 ms intervals. Scale bar, 100 μm. G. The spontaneous firing frequency calculated from (F) for mouse primary cortical neurons incubated with (+ filaments) or without (- filaments) FTLD-TDP Type A patient brain-derived TDP-43 filaments or aged-matched control brain extracts (+ control) for 9 d (d9) and 14 d (d14). Each data point represents one time-lapse recording. Data points are colour coded by biological replicate. n = 5 biological replicates. Means +/- SD are shown. A two-way ANOVA with Tukey’s multiple comparison test was performed, **p<0.01, ****p<0.0001.

Article Snippet: The grids were then blotted and incubated with anti-TDP-43 primary antibody (Proteintech, 10782-2-AP; 1:25) diluted in blocking buffer for 3 h at 21°C.

Techniques: Expressing, Fluorescence, Incubation, Derivative Assay, Control, Activity Assay, Comparison, Microscopy